Cloning flanking DNA from pD991 enhancer trap T-DNA inserts

We have used three methods to clone flanking genomic DNA from out T-DNA enhancer trap lines with vector pD991

1) Inverse PCR

oligo 86 - 5' TCGGGCCTAACTTTTGGTG 3' (adjacent RB nick)

oligo 87 - 5' GAGGTCTCATTCGCCATTC 3' (adjacent RB nick)

oligo 96 - 5' AGTGCCAAGCTTGCATGC 3' (Hind III site in polylinker)

oligo 97 - 5; CTCTCCTGGCGCACCATCG 3' (3' end of GUS)

The positions of the oligos are marked on the pD991 right border sequence. We have had better success using oligos 86 and 96; oligo 87 probably does not work as well because of the GC rich region that is present between that oligo and the polylinker ; we have difficulty sequencing across this region).

Enzymes to use for iPCR using 86 and 96: PstI, XbaI, BamHI (BamHI/BglII, BamHI/BclI), SalI (SalI/XhoI), SacI

iPCR can also be performed on the right border using enzymes EcoRI and XhoI with oligos 86 and 97.

We have determined the sequence adjacent to the left border (see pD991 left border sequence). We have not performed iPCR on the left border but it should be possible to synthesize oligos based on the left border sequence or on the published sequence of 5' mas (Barker et al., Plant Mol. Biol. 2, 335-350 (1983)).

 

2) Partial genomic libraries

Based on genomic Southern data, we can estimate the number of T-DNA insertions as well as the sizes of various restriction fragments that contain the T-DNA. Generally, we digest genomic DNA from an emhancer trap line with the following enzymes: HindIII, EcoRI, MfeI, BclI, BamHI, BglII, XbaI, PstI, KpnI, XhoI, SacI, and SalI. We probe the blot with 1) a right border probe (256 bp SacI/HindIII from pD991), 2) a GUS probe (1.9 kb BamHI/SacI from pD991), and a left border probe (1 kb XhoI fragment from pD991). If we see < 3kb band using a right border probe cut with PstI, XbaI, SalI, SacI, or BamHI or less than 5 kb with EcoRI or XhoI than we pursue iPCR using right border oligos. If we get a band <4kb with the left border probe with EcoRI, then we will pursue iPCR with the left border oligos. If we see a Southern band between 12-20 kb with EcoRI, MfeI, BamHI, BclI, or BglII then we can attempt to construct a partial library using lambda DASHII arms (cut with either BamHI or EcoRI) and packaging mixes purchased from Stratagene. In our hands, these partial libraries yield positives about 1 per 3-5000 plaques screened.

 

3) TAIL-PCR

T-DNA inserts are isolated using the procedure described in Liu et al. Plant J. 8, 457-463 (1995). We use thin-walled PCR tubes, commercial Taq enzyme (from Perkin-Elmer) and an M.J. Research PTC-100 Programmable Thermal Controller (programmed using the first set of times given on page 459 of the Liu et al. paper). The starting DNA is from a quick DNA prep. The oligos used are as follows:

We use three right border specific oligos (indicated on the pD991 right border sequence ):

oligo 123: 5' GCATGCAAGCTTGGCACTGG 3'

oligo 124: 5' TGAGACCTCAATTGCGAGC 3'

oligo 86 - 5' TCGGGCCTAACTTTTGGTG 3'

 

We use three left border specific oligos (indicated on the pD991 left border sequence):

oligo 156: 5' CCTATAAATACGACGGATCG 3'

oligo 155: 5' ATAACGCTGCGGACATCTAC 3'

oligo 154: 5' TGATCCATGTAGATTTCCCG 3'

 

As well as the three degenerate TAIL-PCR oligos that are described in the Liu et al. paper:

AD1 : 5' NTCGA(G/C)T(A/T)T(G/C)G(A/T)GTT 3'

AD2 : 5' NGTCGA(G/C)(A/T)GANA(A/T)GAA 3'

AD3 : 5' (A/T)GTGNAG(A/T)ANCANAGA 3'

 

We do three rounds of PCR as described in the paper. Positive results from the tertiary reaction are checked by repeating the tertiary TAIL PCR with each oligo individually as well as with each (123, 124, or 86) / AD oligo pairs. This is done to ensure that the amplified products are specific for both oligos. After checking the tertiary products, we perform a fourth PCR reaction. All concentrations are the same as in the tertiary reactions except that the DNA is not diluted. The oligos are kinased so that the resulting PCR products can be directly subcloned into plasmid cloning vectors suitable for DNA sequencing (e.g pGEM, pBS etc.).

 

Tom Jack
Department of Biological Sciences
Dartmouth College, Hanover, NH USA
Phone: (603) 646-3367
FAX: (603) 646-1347
 
last updated 1/20/99
 
return to top
 
return to main menu