Erives Lab

Main Page

People

Publications

Contact

Links

"Wovon man nicht sprechen kann, daruber muss man schweigen."
—Wittgenstein

 

Current list of all publications on PUBMED

Erives, A. (2011). A model of proto-anti-codon RNAs requiring L-amino acid homochirality. J. Molecular Evolution doi 10.1007/s00239-011-9453-4.

Crocker, J., Potter, N. and Erives, A. (2010) Dynamic evolution of precise regulatory encodings creates the clustered site signature of enhancers. Nature Communications 1:99 doi: 10.1038/ncomms1102.

Kugler, J.E., Gazdoiu, S., Oda-Ishii, I., Passamaneck, Y.J., Erives, A.J. and Di Gregorio, A. (2010) Temporal regulation of the muscle gene cascade by Macho1 and Tbx6 transcription factors in Ciona intestinalis. J Cell Science 123:2453-2463.

Erives, A. (2009) Non-homologous structured CRMs from the Ciona genome. J Comp Biology 16:369-77.

Crocker, J. and Erives, A. (2008) A closer look at the eve stripe 2 enhancers of Drosophila and Themira. PLoS Genetics 4(11):e1000276

Brown, S., Cole, M. and Erives, A.J. (2008) Evolution of the holozoan ribosome biogenesis regulon. BMC Genomics 9:442.

Crocker, J., Tamori, Y. and Erives, A. (2008) Evolution acts on enhancer organization to fine-tune gradient threshold readouts. PLoS Biology 6(11):e263.

Erives, A., Levine, M. (2004) Coordinate enhancers share common organizational features in the Drosophila genome. Proc. Nat. Acad. Sci. U.S.A. 101:3851-6.

Markstein, M., Zinzen, R., Markstein, P., Yee, K., Erives, A., Stathopoulos, A., Levine, M. (2004) A regulatory code for neurogenic gene expression in the Drosophila embryo. Development 131: 2387-94.

Stathopoulos, A., Van Drenth, M., Erives, A., Markstein, M. and Levine, M. (2002) Whole-Genome Analysis of Dorso- Ventral Patterning in the Drosophila Embryo. Cell 111: 687-701.

Erives, A., Levine, M. (2001) Cis-regulation of ascidian tail muscle genes. Proceedings of the First International Symposium on the Biology of Ascidians. Springer-Verlag, Tokyo 2001.

Erives, A. and Levine, M. (2000) Characterization of a maternal T-box gene in Ciona intestinalis. Developmental Biology 225: 169-178.

Hotta, K., Takahashi, H., Erives, A., Levine, M. and Satoh, N. (1999) Temporal expression patterns of 39 Brachyury-downstream genes associated with notochord formation in the Ciona intestinalis embryo. Development Growth & Differentiation 41: 657-664.

Takahashi, H., Hotta, K., Erives, A., Di Gregorio, A., Zeller, R.W., Levine, M. and Satoh, N. (1999) Brachyury downstream notochord differentiation in the ascidian embryo. Genes & Development 13: 1519-1523.

Erives, A., Corbo, J.C., Levine, M. (1998) Lineage-specific regulation of the Ciona snail gene in the embryonic mesoderm and neuroectoderm. Developmental Biology 194: 213-225.

Corbo, J.C., Erives, A., Di Gregorio, A., Chang, A. and Levine, M. (1997) Dorsoventral patterning of the vertebrate neural tube is conserved in a protochordate. Development 124: 2335-2344.


"Never express yourself more clearly than you are able to think"

—Niels Bohr

"No, no, you're not thinking; you're just being logical."

—Niels Bohr

"How wonderful that we have met with a paradox. Now we have some hope of making progress."

—Niels Bohr


...aattgagcatcccaatg ttgcggattcacaggacgaa cactttttaataataagtat acctggttttgttttcagGT GTCGTTATTTGTGCAACAAC ATTGAAAAACAAGCAGAAAT AAAACATTGACGGAACGGAT ACGACCGCAGATTGCGGGAG CTGTCCTCTCAATCAGCCCG GCAGCGGCGGCCCACAATTT ACGCGTGTGCAACCCTAACC CCGGCCCAAGCTTGACCTAC AATTTGCGCAGGCGCAGATC CTAACTTTGGCGTCCCTGTG GGCGGCCTTTGGTGTGAGAC GCGTGGTATTCTGGGAACGT CGGAGACGGAAGTTACTTCG TCTTTAGCTCCTGGCGCTGC TGGCTTCTGGGCGGTTTTTG TCTTTTGATTTCAAGAGTTA GGAGCTCGAGAACCGTTTGG CAATATGTACGACGCGGATG AGGgtaggtgaacgctcaaa acacacgccgtggcggtcca tttaagcaggaaagcgttgg gaactgattggattgaggat ttggggccttcccatgcgcc ggctgcacagtccccagcct tgttcccacacttaccaggc cgggaacgaaactgggg...

The DNA sequence is highlighted to show the intron splice sites as well as the beginning of this gene's protein-coding sequence. Click through our pages to find out what that protein is!