Erives Lab

Main Page

People

Publications

Contact

Links

 

"All mass is interaction." —Richard Feynman

Principal Investigator:

Albert Erives, Ph.D. - Curriculum Vitae

Current Lab Members:

Emily Boggs

Tewende Anani Sawadogo

Wendy Xiao

Sean Kaufman

Wenhao Shi


...ggtccttataaaggcaa ataaattgagcatcccaatg ttgcggattcacaggacgaa cactttttaataataagtat acctggttttgttttcagGT GTCGTTATTTGTGCAACAAC ATTGAAAAACAAGCAGAAAT AAAACATTGACGGAACGGAT ACGACCGCAGATTGCGGGAG CTGTCCTCTCAATCAGCCCG GCAGCGGCGGCCCACAATTT ACGCGTGTGCAACCCTAACC CCGGCCCAAGCTTGACCTAC AATTTGCGCAGGCGCAGATC CTAACTTTGGCGTCCCTGTG GGCGGCCTTTGGTGTGAGAC GCGTGGTATTCTGGGAACGT CGGAGACGGAAGTTACTTCG TCTTTAGCTCCTGGCGCTGC TGGCTTCTGGGCGGTTTTTG TCTTTTGATTTCAAGAGTTA GGAGCTCGAGAACCGTTTGG CAATATGTACGACGCGGATG AGGgtaggtgaacgctcaaa acacacgccgtggcggtcca tttaagcaggaaagcgttgg gaactgattggattgaggat ttggggccttcccatgcgcc ggctgcacagtccccag...

The 365 purple, uppercase letters in the DNA sequence constitute the second exon of a very important gene! Click through our lab web pages to find out more!