Erives Lab

Main Page

People

Publications

Contact

Links

 

Graduate programs at Dartmouth
Undergraduate programs at Dartmouth
   


...tttttaataataagtat acctggttttgttttcagGT GTCGTTATTTGTGCAACAAC ATTGAAAAACAAGCAGAAAT AAAACATTGACGGAACGGAT ACGACCGCAGATTGCGGGAG CTGTCCTCTCAATCAGCCCG GCAGCGGCGGCCCACAATTT ACGCGTGTGCAACCCTAACC CCGGCCCAAGCTTGACCTAC AATTTGCGCAGGCGCAGATC CTAACTTTGGCGTCCCTGTG GGCGGCCTTTGGTGTGAGAC GCGTGGTATTCTGGGAACGT CGGAGACGGAAGTTACTTCG TCTTTAGCTCCTGGCGCTGC TGGCTTCTGGGCGGTTTTTG TCTTTTGATTTCAAGAGTTA GGAGCTCGAGAACCGTTTGG CAATATGTACGACGCGGATG AGGgtaggtgaacgctcaaa acacacgccgtggcggtcca tttaagcaggaaagcgttgg gaactgattggattgag...

Click here to be taken to a page showing where this sequence is located in the human genome: UCSC Genome Browser