Erives Lab

Main Page

People

Publications

Contact

Links

 

Our lab is moving to the Department of Biology at the University of Iowa in January (2012).


  • Current mailing address and physical location:

    Room 4
    Life Sciences Center
    78 College St
    Dartmouth College
    Hanover, NH 03766

  • Office: Room 25, (603) 646-1533
  • Laboratory: (603) 646-1532
  • FAX: (603) 646-1541
  • E-mail: albert-erives AT uiowa DOT e d u


...ggtccttataaaggcaa ataaattgagcatcccaatg ttgcggattcacaggacgaa cactttttaataataagtat acctggttttgttttcagGT GTCGTTATTTGTGCAACAAC ATTGAAAAACAAGCAGAAAT AAAACATTGACGGAACGGAT ACGACCGCAGATTGCGGGAG CTGTCCTCTCAATCAGCCCG GCAGCGGCGGCCCACAATTT ACGCGTGTGCAACCCTAACC CCGGCCCAAGCTTGACCTAC AATTTGCGCAGGCGCAGATC CTAACTTTGGCGTCCCTGTG GGCGGCCTTTGGTGTGAGAC GCGTGGTATTCTGGGAACGT CGGAGACGGAAGTTACTTCG TCTTTAGCTCCTGGCGCTGC TGGCTTCTGGGCGGTTTTTG TCTTTTGATTTCAAGAGTTA GGAGCTCGAGAACCGTTTGG CAATATGTACGACGCGGATG AGGgtaggtgaacgctcaaa acacacgccgtggcggtcca tttaagcaggaaagcgttgg gaactgattggattgaggat ttggggccttcccatgcgcc ggctgcacagtccccagcct tgttcccacacttaccaggc cgggaacgaaactggggtag ggagaggcggagggtgcagg gaacatagtgttaatgt...

The DNA sequence above is a short snippet from the human gene that encodes the large subunit of DNA-directed RNA polymerase II, which mediates the transcriptional expression of most genes!